Morpho-Physiological and Metabolic Responses and Expression Profiling of the CcTCP Gene Family in Pigeon Pea under Salt Stress

doi:10.7525/j.issn.1673-5102.2026.04.013

Abstract

Abstract:

To systematically elucidate the growth response characteristics of pigeon pea（Cajanus cajan） seedlings under different concentrations of salt stress and the dynamic changes in antioxidant enzyme activities and flavonoid metabolite accumulation， uniformly grown pigeon pea seedlings were used as plant materials. The seedlings were treated with 0， 50， 100， 150， and 200 mmol⋅L^-1 NaCl solution. Phenotypic observation and root scanning analysis were conducted at 1， 3， 5， and 7 days after treatment. Root morphological parameters， including root length， surface area， projected area， volume， and average diameter， were measured. Meanwhile， the activities of superoxide dismutase（SOD） and peroxidase（POD） were determined. In addition， samples collected under 150 mmol⋅L^-1 NaCl treatment at different time points were analyzed using UPLC-MS/MS for qualitative and quantitative profiling of flavonoid metabolites， combined with analysis of related gene expression changes. Results showed that salt stress significantly inhibited the growth of pigeon pea seedlings in a concentration-dependent manner. With increasing salt concentration and prolonged treatment duration， seedlings exhibited inhibited primary root elongation， restricted lateral root development， and reduced shoot growth， with the inhibitory effect becoming more pronounced after 3 days of treatment. Root morphological parameters generally increased over time； however， the magnitude of increase was significantly reduced under 100 mmol⋅L^-1 and higher NaCl treatments， whereas 50 mmol⋅L^-1 NaCl showed a promoting effect on root growth at certain time points. The average root diameter showed relatively small variation under 50 mmol⋅L^-1 NaCl treatment but slight increase under moderate to high salt conditions. SOD activity increased significantly under moderate salt concentration and then stabilized， while POD activity continuously increased with increasing salt concentration and treatment duration. Under 150 mmol⋅L^-1 NaCl treatment， flavonoid metabolites in roots exhibited stage-dependent accumulation patterns. Root stilbene acid mass concentration showed an overall increasing trend， isovitexin mass concentration fluctuated markedly， genistin displayed induced accumulation， and genistein mass concentration significantly increased at later stages of treatment. Gene expression analysis showed that the expression levels of CcPAL2， Cc4CL4， and CcCHS3 were downregulated， while CcC4H1 was significantly upregulated， and CcCHI2 and CcIFS1 were also induced. In conclusion， salt stress inhibited the growth of pigeon pea seedlings and showed clear time- and concentration-dependent effects. Antioxidant enzyme activities and flavonoid metabolite levels dynamically changed during the stress process， and the key genes in the flavonoid biosynthesis pathway exhibited differential regulation under salt stress conditions.

Key words: pigeon pea, salt stress, root system architecture, flavonoid secondary metabolites

CLC Number:

Q945

Yaoyuan YAO, Jie YANG, Yuexin ZHANG, Yujie FU. Morpho-Physiological and Metabolic Responses and Expression Profiling of the CcTCP Gene Family in Pigeon Pea under Salt Stress[J]. Bulletin of Botanical Research, 2026, 46(4): 728-739.

Figures/Tables 7

Table 1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

References 29

[1]	Hassani A， Azapagic A， Shokri N.Global predictions of primary soil salinization under changing climate in the 21st century［J］.Nature Communications，2021，12：6663.
[2]	Shokri N， Hassani A， Sahimi M.Multi-scale soil salinization dynamics from global to pore scale：a review［J］.Reviews of Geophysics，2024，62（4）：e2023RG000804.
[3]	Zhou H P， Shi H F， Yang Y Q，et al.Insights into plant salt stress signaling and tolerance［J］.Journal of Genetics and Genomics，2024，51（1）：16-34.
[4]	Singh D.Juggling with reactive oxygen species and antioxidant defense system：a coping mechanism under salt stress［J］.Plant Stress，2022，5：100093.
[5]	Wang H Q， Sun J， Ren H，et al.Inhibiting reactive oxygen species production mitigates endoplasmic reticulum damage in florets of developing maize ears under heat stress［J］.The Plant Journal，2025，122（5）：e70243.
[6]	Lu X， Chen G P， Ma L，et al.Integrated transcriptome and metabolome analysis reveals antioxidant machinery in grapevine exposed to salt and alkali stress［J］.Physiologia Plantarum，2023，175（3）：e13950.
[7]	Zhang X Y， He P Y， Guo R Y，et al.Effects of salt stress on root morphology，carbon and nitrogen metabolism，and yield of Tartary buckwheat［J］.Scientific Reports，2023，13：12483.
[8]	Zhang L， Zhang Z J， Fang S Z，et al.Integrative analysis of metabolome and transcriptome reveals molecular regulatory mechanism of flavonoid biosynthesis in Cyclocarya paliurus under salt stress［J］.Industrial Crops and Products，2021，170：113823.
[9]	Wang C L， Wei X T， Wang Y M，et al.Metabolomics and transcriptomic analysis revealed the response mechanism of maize to saline-alkali stress［J］.Plant Biotechnology Journal，2025，23（12）：5397-5416.
[10]	Su L T， Lv A M， Wen W W，et al.MsMYB206-MsMYB450-MsHY5 complex regulates alfalfa tolerance to salt stress via regulating flavonoid biosynthesis during the day and night cycles［J］.The Plant Journal，2025，121（2）：e17216.
[11]	Zheng X Y， Zhang X J， Zeng F K.The regulatory network composed of phytohormones，transcription factors and non-coding RNAs is involved in the flavonoids biosynthesis of fruits［J］.Horticultural Plant Journal，2026，12（3）：497-508.
[12]	Liu C， Tai Y L， Luo J J，et al.Integrated multi-omics analysis provides insights into genome evolution and phosphorus deficiency adaptation in pigeonpea （Cajanus cajan）［J］.Horticulture Research，2022，9：uhac107.
[13]	Awana M， Jain N， Samota M K，et al.Protein and gene integration analysis through proteome and transcriptome brings new insight into salt stress tolerance in pigeonpea （Cajanus cajan L.）［J］.International Journal of Biological Macromolecules，2020，164：3589-3602.
[14]	Du T T， Fan Y X， Cao H Y，et al.Transcriptome analysis revealed key genes involved in flavonoid metabolism in response to jasmonic acid in pigeon pea （Cajanus cajan （L.） Millsp.）［J］.Plant Physiology and Biochemistry，2021，168：410-422.
[15]	Yang W L， Li N， Fan Y X，et al.Transcriptome analysis reveals abscisic acid enhancing drought resistance by regulating genes related to flavonoid metabolism in pigeon pea［J］.Environmental and Experimental Botany，2021，191：104627.
[16]	Meng D， Dong B Y， Niu L L，et al.The pigeon pea CcCIPK14-CcCBL1 pair positively modulates drought tolerance by enhancing flavonoid biosynthesis［J］.The Plant Journal，2021，106（5）：1278-1297.
[17]	Giannopolitis C N， Ries S K.Superoxide dismutases：Ⅰ.occurrence in higher plants［J］.Plant Physiology，1977，59（2）：309-314.
[18]	Liu C X， Gu C Y， Huang W，et al.Targeted UPLC-MS/MS high-throughput metabolomics approach to assess the purine and pyrimidine metabolism［J］.Journal of Chromatography B，2019，1113：98-106.
[19]	Livak K J， Schmittgen T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method［J］.Methods，2001，25（4）：402-408.
[20]	Khan F， Siddiqi T O，Mahmooduzzafar，et al.Morphological changes and antioxidant defence systems in soybean genotypes as affected by salt stress［J］.Journal of Plant Interactions，2009，4（4）：295-306.
[21]	Lan J Q， Qin G J.The regulation of CIN-like TCP transcription factors［J］.International Journal of Molecular Sciences，2020，21（12）：4498.
[22]	Gill S S， Tuteja N.Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants［J］.Plant Physiology and Biochemistry，2010，48（12）：909-930.
[23]	Passardi F， Penel C， Dunand C.Performing the paradoxical：how plant peroxidases modify the cell wall［J］.Trends in Plant Science，2004，9（11）：534-540.
[24]	Mittova V， Tal M， Volokita M，et al.Salt stress induces up-regulation of an efficient chloroplast antioxidant system in the salt-tolerant wild tomato species Lycopersicon pennellii but not in the cultivated species［J］.Physiologia Plantarum，2002，115（3）：393-400.
[25]	Gharsallah C， Fakhfakh H， Grubb D，et al.Effect of salt stress on ion concentration，proline content，antioxidant enzyme activities and gene expression in tomato cultivars［J］.AoB Plants，2016，8：plw055.
[26]	Demiral T， Türkan İ.Comparative lipid peroxidation，antioxidant defense systems and proline content in roots of two rice cultivars differing in salt tolerance［J］.Environmental and Experimental Botany，2005，53（3）：247-257.
[27]	Mittler R， Zandalinas S I， Fichman Y，et al.Reactive oxygen species signalling in plant stress responses［J］.Nature Reviews Molecular Cell Biology，2022，23（10）：663-679.
[28]	Miransari M， Smith D L.Alleviating salt stress on soybean （Glycine max （L.） Merr.）-Bradyrhizobium japonicum symbiosis，using signal molecule genistein［J］.European Journal of Soil Biology，2009，45（2）：146-152.
[29]	Wang Y B， Liu W， Li W，et al.Integrative analysis of metabolome and transcriptome reveals regulatory mechanisms of flavonoid biosynthesis in soybean under salt stress［J］.Frontiers in Plant Science，2024，15：1415867.

基因名称 Gene name	上游引物（5′→3′） Forward primer（5′→3′）	下游引物（5′→3′） Reverse primer（5′→3′）
qCcActin	AAGCTCAGTCCAAGAGAGGT	ACATGGCGGGGGTATTGAAG
qCcPAL2	TGAACAACGGGACCGACAGT	AAAACCTGATGAGTTCCTTCTGC
qCc4CL4	GCTGACGCACAAGAGTCTGATG	CAGCAACGCCCTAATCTCAA
qCcC4H1	CCTATGGTCCCGTTTTCCTACT	TGAGTGGAGGACATGTGTGGC
qCcCHS3	ACGCCAGGCAGGACATAGTA	ACTTTGGTTGACCCCATTCC
qCcCHI2	CCTCCGCCAAGACCTATTTC	CGAGTGATTGGATGGCTTGA
qCcIFS1	AGCCCTTCGCCACCTACCTAA	GGGAATAGTGGAGAAGGGGTTT