Phytohormone-mediated Modulation of UV-B Stress Physiological Responses in Male and Female Populus cathayana

doi:10.7525/j.issn.1673-5102.2026.04.006

Abstract

Abstract:

Light is an indispensable environmental factor for plant growth and development. However， UV-B radiation interferes with normal growth processes， causing oxidative damage and inhibiting photosynthesis. To explore the morphological and physiological characteristics and underlying mechanisms of poplars to UV-B stress， dioecious Populus cathayana were used as materials. The cuttings were subjected to UV-B stress alone or combined with exogenous applications of exogenous phytohormones（indole-3-acetic acid（IAA）， 1-aminocyclo-propanecarboxylic acid（ACC）， methyl jasmonate（MeJA）， salicylic acid（SA） and melatonin（MT））. A series of indictors were conducted， including leaf photosynthetic parameters， antioxidant activities， hormone contents， relative expression levels of related genes， anthocyanin contents in stems and leaves， as well as principal component analysis（PCA）. Results showed that under UV-B stress， the net photosynthetic efficiency decreased， and the reactive oxygen species（ROS） molality increased in P.cathayana leaves， with male exhibiting stronger tolerance to UV-B than female P.cathayana. Exogenous hormone applications alleviated UV-B stress-induced damage by improving leaf photosynthetic performance and regulating ROS homeostasis. Specifically， IAA， ACC， and MT treatments exerted more pronounced alleviating effects on female than that on male P.cathayana under UV-B stress. SA application significantly reduced the H₂O₂ content in leaves. MeJA application promoted organ anthocyanin accumulation， decreased leaf H₂O₂ content， and enhanced net photosynthetic efficiency and UV-B tolerance on P. cathayana. In addition， the relative expression levels of PtrJAZ1/2/3/5/9 genes were significantly upregulated under both UV-B stress and MeJA treatment， suggesting that these genes may act as key regulators in the JA signaling pathway， mediating anthocyanin synthesis and stress responses. In conclusion， males displayed greater physiological plasticity and stress resistance potential than female P. cathayana under UV-B radiation stress. This study provides practical insights for stress-resistant plant cultivation and hormone regulation in practices.

Key words: poplar, dioecy, UV-B stress, phytohormone, anthocyanin

CLC Number:

Q945.78

Fangyu SHEN, Yu ZHANG, Yin ZHANG, Fan CHEN, Jian LIU, Yujie DAI, Xuechi ZHANG, Sheng ZHANG. Phytohormone-mediated Modulation of UV-B Stress Physiological Responses in Male and Female Populus cathayana[J]. Bulletin of Botanical Research, 2026, 46(4): 642-654.

Figures/Tables 10

Table 1

Table 2

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

Fig.7

Fig.8

References 54

[1]	Kami C， Lorrain S， Hornitschek P，et al.Light-regulated plant growth and development［M］//Timmermans M C P.Current topics in developmental biology：plant development.San Diego：Academic Press，2010：29-66.
[2]	Hideg É， Jansen M A K， Strid Å.UV-B exposure，ROS，and stress：inseparable companions or loosely linked associates？［J］.Trends in Plant Science，2013，18（2）：107-115.
[3]	Kataria S， Jajoo A， Guruprasad K N.Impact of increasing ultraviolet-B（UV-B） radiation on photosynthetic processes［J］.Journal of Photochemistry and Photobiology B：Biology，2014，137：55-66.
[4]	Dai Y J， Li M H， Li H H，et al.Phytohormone-regulated UV-B photomorphogenesis and acclimation［J］.Environmental and Experimental Botany，2024，224：105830.
[5]	Rizzini L， Favory J J， Cloix C，et al.Perception of UV-B by the Arabidopsis UVR8 protein［J］.Science，2011，332（6025）：103-106.
[6]	Jenkins G I.The UV-B photoreceptor UVR8：from structure to physiology［J］.The Plant Cell，2014，26（1）：21-37.
[7]	Gruber H， Heijde M， Heller W，et al.Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis ［J］.Proceedings of the National Academy of Sciences of the United States of America，2010，107（46）：20132-20137.
[8]	Podolec R， Lau K， Wagnon T B，et al.A constitutively monomeric UVR8 photoreceptor confers enhanced UV-B photomorphogenesis［J］.Proceedings of the National Academy of Sciences of the United States of America，2021，118（6）：e2017284118.
[9]	Bieza K， Lois R.An Arabidopsis mutant tolerant to lethal ultraviolet-B levels shows constitutively elevated accumulation of flavonoids and other phenolics［J］.Plant Physiology，2001，126（3）：1105-1115.
[10]	Pietta P G.Flavonoids as antioxidants［J］.Journal of Natural Products，2000，63（7）：1035-1042.
[11]	Ferreyra M L F， Serra P， Casati P.Recent advances on the roles of flavonoids as plant protective molecules after UV and high light exposure［J］.Physiologia Plantarum，2021，173（3）：736-749.
[12]	Qian C Z， Chen Z R， Liu Q，et al.Coordinated transcriptional regulation by the UV-B photoreceptor and multiple transcription factors for plant UV-B responses［J］.Molecular Plant，2020，13（5）：777-792.
[13]	Haskirli H， Yilmaz O， Ozgur R，et al.Melatonin mitigates UV-B stress via regulating oxidative stress response，cellular redox and alternative electron sinks in Arabidopsis thaliana ［J］.Phytochemistry，2021，182：112592.
[14]	Li C， Du J C， Xu H N，et al.UVR8-TCP4-LOX2 module regulates UV-B tolerance in Arabidopsis ［J］.Journal of Integrative Plant Biology，2024，66（5）：897-908.
[15]	Bandurska H， Cieślak M.The interactive effect of water deficit and UV-B radiation on salicylic acid accumulation in barley roots and leaves［J］.Environmental and Experimental Botany，2013，94：9-18.
[16]	An J P， Xu R R， Liu X，et al.Jasmonate induces biosynthesis of anthocyanin and proanthocyanidin in apple by mediating the JAZ1-TRB1-MYB9 complex［J］.The Plant Journal，2021，106（5）：1414-1430.
[17]	Liu S C， Wang Y， Shi M，et al.SmbHLH60 and SmMYC2 antagonistically regulate phenolic acids and anthocyanins biosynthesis in Salvia miltiorrhiza ［J］.Journal of Advanced Research，2022，42：205-219.
[18]	Pontin M A， Piccoli P N， Francisco R，et al.Transcriptome changes in grapevine（Vitis vinifera L.） cv.Malbec leaves induced by ultraviolet-B radiation［J］.BMC Plant Biology，2010，10（1）：224.
[19]	Ge X M， Hu X， Zhang J，et al.RESISTANCE LOCUSUV8 mediates ultraviolet-B-induced stomatal closure in an ethylene-dependent manner［J］.Plant Science，2020，301：110679.
[20]	Zhao J Y， Bo K L， Pan Y P，et al.Phytochrome-interacting factor PIF3 integrates phytochrome B and UV-B signaling pathways to regulate gibberellin- and auxin-dependent growth in cucumber hypocotyls［J］.Journal of Experimental Botany，2023，74（15）：4520-4539.
[21]	Tuskan G A， DiFazio S， Jansson S，et al.The genome of black cottonwood，Populus trichocarpa（Torr. & Gray）［J］.Science，2006，313（5793）：1596-1604.
[22]	Brunner A M， Busov V B， Strauss S H.Poplar genome sequence：functional genomics in an ecologically dominant plant species［J］.Trends in Plant Science，2004，9（1）：49-56.
[23]	Xu X， Zhao H X， Zhang X L，et al.Different growth sensitivity to enhanced UV-B radiation between male and female Populus cathayana ［J］.Tree Physiology，2010，30（12）：1489-1498.
[24]	Liu M， Korpelainen H， Li C Y.Sexual differences and sex ratios of dioecious plants under stressful environments［J］.Journal of Plant Ecology，2021，14（5）：920-933.
[25]	Xiang X D， Zhou X L， Zi H L，et al. Populus cathayana genome and population resequencing provide insights into its evolution and adaptation［J］.Horticulture Research，2024，11（1）：uhad255.
[26]	Jin X， Zimmermann J， Polle A，et al.Auxin is a long-range signal that acts independently of ethylene signaling on leaf abscission in Populus ［J］.Frontiers in Plant Science，2015，6：634.
[27]	Wang Y C， Wang N， Xu H F，et al.Auxin regulates anthocyanin biosynthesis through the Aux/IAA-ARF signaling pathway in apple［J］.Horticulture Research，2018，5：59.
[28]	Xu C Z， Shen Y， He F，et al.Auxin-mediated Aux/IAA-ARF-HB signaling cascade regulates secondary xylem development in Populus ［J］.New Phytologist，2019，222（2）：752-767.
[29]	Liu H J， Zhang H， Yang F，et al.Ethylene activates poplar defense against Dothiorella gregaria Sacc by regulating reactive oxygen species accumulation［J］.Physiologia Plantarum，2022，174（3）：e13726.
[30]	Felten J， Vahala J， Love J，et al.Ethylene signaling induces gelatinous layers with typical features of tension wood in hybrid aspen［J］.New Phytologist，2018，218（3）：999-1014.
[31]	Ullah C， Schmidt A， Reichelt M，et al.Lack of antagonism between salicylic acid and jasmonate signalling pathways in poplar［J］.New Phytologist，2022，235（2）：701-717.
[32]	Kong L F， Song Q， Wei H B，et al.The AP2/ERF transcription factor PtoERF15 confers drought tolerance via JA-mediated signaling in Populus ［J］.New Phytologist，2023，240（5）：1848-1867.
[33]	Wu J， Liang X Y， Lin M，et al.Comprehensive analysis of MAPK gene family in Populus trichocarpa and physiological characterization of PtMAPK3-1 in response to MeJA induction［J］.Physiologia Plantarum，2023，175（1）：e13869.
[34]	Zafar Z， Rasheed F， Atif R M，et al.Foliar application of salicylic acid improves water stress tolerance in Conocarpus erectus L. and Populus deltoides L. saplings：evidence from morphological，physiological，and biochemical changes［J］.Plants，2021，10（6）：1242.
[35]	Yu P Z， Tang X， Chen B L，et al.The melatonin synthase-encoding gene ASMT mediates poplar resistance to drought stress and fungi Dothiorella gregaria ［J］.Gene，2025，937：149154.
[36]	Xu H P， Zhang S Y， Liang C L，et al.Melatonin enhances resistance to Botryosphaeria dothidea in pear by promoting jasmonic acid and phlorizin biosynthesis［J］.BMC Plant Biology，2024，24（1）：470.
[37]	Sun H L， Cao X Y， Wang X Y，et al.RBOH-dependent hydrogen peroxide signaling mediates melatonin-induced anthocyanin biosynthesis in red pear fruit［J］.Plant Science，2021，313：111093.
[38]	Ding F， Wang G， Zhang S X.Exogenous melatonin mitigates methyl viologen-triggered oxidative stress in poplar leaf［J］.Molecules，2018，23（11）：2852.
[39]	Rabino I， Mancinelli A L.Light，temperature，and anthocyanin production［J］.Plant Physiology，1986，81（3）：922-924.
[40]	Lichtenthaler H K.Chlorophylls and carotenoids：pigments of photosynthetic biomembranes［M］//Packer L，Douce R.Methods in enzymology：plant cell membranes.San Diego：Academic Press，1987：350-382.
[41]	Boussadia O， Steppe K， Zgallai H，et al.Effects of nitrogen deficiency on leaf photosynthesis，carbohydrate status and biomass production in two olive cultivars ‘Meski’ and ‘Koroneiki’［J］.Scientia Horticulturae，2010，123（3）：336-342.
[42]	Jiang H， Zhang S， Feng L H，et al.Transcriptional profiling in dioecious plant Populus cathayana reveals potential and sex-related molecular adaptations to solar UV-B radiation［J］.Physiologia Plantarum，2015，153（1）：105-118.
[43]	Ruban A V， Wilson S.The mechanism of non-photochemical quenching in plants：localization and driving forces［J］.Plant and Cell Physiology，2021，62（7）：1063-1072.
[44]	Landi M， Tattini M， Gould K S.Multiple functional roles of anthocyanins in plant-environment interactions［J］.Environmental and Experimental Botany，2015，119：4-17.
[45]	Steyn W J， Wand S J E， Holcroft D M，et al.Anthocyanins in vegetative tissues：a proposed unified function in photoprotection［J］.New Phytologist，2002，155（3）：349-361.
[46]	Hughes N M， Morley C B， Smith W K.Coordination of anthocyanin decline and photosynthetic maturation in juvenile leaves of three deciduous tree species［J］.New Phytologist，2007，175（4）：675-685.
[47]	Gould K S， Dudle D A， Neufeld H S.Why some stems are red：cauline anthocyanins shield photosystem II against high light stress［J］.Journal of Experimental Botany，2010，61（10）：2707-2717.
[48]	Cuypers A， Hendrix S， Amaral Dos Reis R，et al.Hydrogen peroxide，signaling in disguise during metal phytotoxicity［J］.Frontiers in Plant Science，2016，7：470.
[49]	Dorion S， Ouellet J C， Rivoal J.Glutathione metabolism in plants under stress：beyond reactive oxygen species detoxification［J］.Metabolites，2021，11（9）：641.
[50]	Choudhary S， Bhat T M， Alwutayd K M，et al.Salicylic acid enhances thermotolerance and antioxidant defense in Trigonella foenum graecum L. under heat stress［J］.Heliyon，2024，10（6）：e27227.
[51]	Li S H， Dong Y X， Li D L，et al.Eggplant transcription factor SmMYB5 integrates jasmonate and light signaling during anthocyanin biosynthesis［J］.Plant Physiology，2024，194（2）：1139-1165.
[52]	Chung H S， Koo A J K， Gao X L，et al.Regulation and function of Arabidopsis JASMONATE ZIM-domain genes in response to wounding and herbivory［J］.Plant Physiology，2008，146（3）：952-964.
[53]	Zhai Q Z， Deng L， Li C Y.Mediator subunit MED25：at the nexus of jasmonate signaling［J］.Current Opinion in Plant Biology，2020，57：78-86.
[54]	Chini A， Fonseca S， Fernández G，et al.The JAZ family of repressors is the missing link in jasmonate signalling［J］.Nature，2007，448（7154）：666-671.

处理组 Treatment group	试验处理 Experimental treatment
CK	喷施蒸馏水（含0.04%乙醇）
sUVB	进行UV-B辐射，喷施蒸馏水（含0.04%乙醇）
UVB+IAA	进行UV-B辐射，喷施30 μmol∙L^-1 IAA
UVB+ACC	进行UV-B辐射，喷施100 μmol∙L^-1 ACC
UVB+MeJA	进行UV-B辐射，喷施250 μmol∙L^-1 MeJA
UVB+SA	进行UV-B辐射，喷施500 μmol∙L^-1 SA
UVB+MT	进行UV-B辐射，喷施100 μmol∙L^-1 MT

引物 Primer	序列（5′→3′） Sequence（5′→3′）
18S-F	CCGTCCTAGTCTCAACCATA
18S-R	CTCTCAGTCTGTCAATCCTTAC
PtrJAZ1-F	TCGTCACCTTCCAAGTCCAA
PtrJAZ1-R	CAGCAGAACCAGAGGCAATC
PtrJAZ2-F	TTCTGTTGCTGCTCTTGATTCC
PtrJAZ2-R	TGATACGGTGCTCTTGCTGTA
PtrJAZ3-F	GCCTTGAGACACCTAGTTCAC
PtrJAZ3-R	AGCCTTGTTAATAGCGTCATCA
PtrJAZ4-F	TTCTCTGTGCCATCTACTCCTA
PtrJAZ4-R	AATGTTCTCCGCCTTGTCTC
PtrJAZ5-F	CGGCTGACAAGGCTAAGGA
PtrJAZ5-R	ACGGAATTGAAATGGTGGACTC
PtrJAZ6-F	AAGGAGCAAGAGGTTACCAATG
PtrJAZ6-R	ACGACAACACTTCCACCATAG
PtrJAZ7-F	AGGCTCAGGCAATCATGTTCT
PtrJAZ7-R	AGGTTGGTTCACAGGACTAAGA
PtrJAZ8-F	AGTCGTCACCTTCCAAGTCC
PtrJAZ8-R	GAACCAGAGGCAATCACGGA
PtrJAZ9-F	CCACCACCACCGTTACCAA
PtrJAZ9-R	GCTTCGCAATCTATCCTCCATT
PtrJAZ10-F	CGGTGGGTCTTCTGGAACG
PtrJAZ10-R	CGCTGACAGGTGGTCTACGAAT
PtrJAZ11-F	ACGCTGGTTCAGTGAGTGTT
PtrJAZ11-R	GCTTGTGCCTGTGCTTGAG
PtrJAZ12-F	AAGAAGCGACGGGACAGGTT
PtrJAZ12-R	TGGTGGAGGTGCGGCACTAAT